Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 2307632
End position: 2307664
Length: 33

DNA sequence
>NC_017295, from 2307632 to 2307664 (33 bp); Clostridium acetobutylicum EA 2018 TTCATTATCAATTCATTATCAATTCTTTATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2307651-2308049	Sequence	CEA_G2231 - Chemotaxis signal transduction protein CheW (Protein is coded in complementary strand; from 2308049 to 2307651)