Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 2297249
End position: 2297278
Length: 30

DNA sequence
>NC_017295, from 2297249 to 2297278 (30 bp); Clostridium acetobutylicum EA 2018 TATATTTCTTTATTTTTTTTTATATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2297269-2297613	Sequence	CEA_G2218 - hypothetical protein (Protein is coded in complementary strand; from 2297613 to 2297269)