Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 2214685
End position: 2214720
Length: 36

DNA sequence
>NC_017295, from 2214685 to 2214720 (36 bp); Clostridium acetobutylicum EA 2018 TTGTTATTCTTTTTCTTCTTCTTTTTTTTCTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2214000-2214749	Sequence	CEA_G2139 divIB Cell division septal protein divIB/FtsQ (Protein is coded in complementary strand; from 2214749 to 2214000)