Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 2008084
End position: 2008107
Length: 24

DNA sequence
>NC_017295, from 2008084 to 2008107 (24 bp); Clostridium acetobutylicum EA 2018 ATTGATATATTGATTTATTGATAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2007143-2008513	Sequence	CEA_G1870 - metal-dependent peptidase (Protein is coded in complementary strand; from 2008513 to 2007143)