Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 1811304
End position: 1811327
Length: 24

DNA sequence
>NC_017295, from 1811304 to 1811327 (24 bp); Clostridium acetobutylicum EA 2018 TATTATTACTATCATTATTATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1811233-1813011	Sequence	CEA_G1682 cstA Carbon starvation protein (Protein is coded in complementary strand; from 1813011 to 1811233)