Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 1663548
End position: 1663577
Length: 30

DNA sequence
>NC_017295, from 1663548 to 1663577 (30 bp); Clostridium acetobutylicum EA 2018 AGTTTTATTAAGTTGTCTTAAGTTTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1663390-1664118	Sequence	CEA_G1536 - hypothetical protein (Protein is coded in complementary strand; from 1664118 to 1663390)