Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 1474974
End position: 1475000
Length: 27

DNA sequence
>NC_017295, from 1474974 to 1475000 (27 bp); Clostridium acetobutylicum EA 2018 TAATTCGTGTAAATCGTGTAATTCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1474447-1475016	Sequence	CEA_G1349 - Spore coat protein F (COTF) related protein (Protein is coded in complementary strand; from 1475016 to 1474447)