Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 1278156
End position: 1278200
Length: 45

DNA sequence
>NC_017295, from 1278156 to 1278200 (45 bp); Clostridium acetobutylicum EA 2018 GTTATACTATTTGCTTGAATACTATTTGCTTGAATACTATTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1275276-1278533	Sequence	CEA_G1125 - hypothetical protein (Protein is coded in complementary strand; from 1278533 to 1275276)