Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 1187045
End position: 1187069
Length: 25

DNA sequence
>NC_017295, from 1187045 to 1187069 (25 bp); Clostridium acetobutylicum EA 2018 AAATCAAACCAAATACAATCAAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1186762-1187481	Sequence	CEA_G1051 - Membrane protein (Protein is coded in complementary strand; from 1187481 to 1186762)