Sequence retrieval

Genome: Clostridium acetobutylicum EA 2018
Start position: 1182672
End position: 1182695
Length: 24

DNA sequence
>NC_017295, from 1182672 to 1182695 (24 bp); Clostridium acetobutylicum EA 2018 TTCTTCTTCTACTTCTTCTTCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1182667-1182861	Sequence	CEA_G1046 - hypothetical protein (Protein is coded in complementary strand; from 1182861 to 1182667)