Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 974560
End position: 974583
Length: 24

DNA sequence
>NC_017278, from 974560 to 974583 (24 bp); Thermus sp. CCB_US3_UF1 CTCCACCTCCAGCACCACCTCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 973751-974659	Sequence	TCCBUS3UF1_9900 - Quinone oxidoreductase (Protein is coded in complementary strand; from 974659 to 973751)