Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 849622
End position: 849645
Length: 24

DNA sequence
>NC_017278, from 849622 to 849645 (24 bp); Thermus sp. CCB_US3_UF1 AGGCCCAGGGCCAGCCCCAGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 848674-850254	Sequence	TCCBUS3UF1_8660 - hypothetical protein (Protein is coded in complementary strand; from 850254 to 848674)