Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 77087
End position: 77110
Length: 24

DNA sequence
>NC_017278, from 77087 to 77110 (24 bp); Thermus sp. CCB_US3_UF1 CCACCCCCTCCCCCACCGCCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 76311-80309	Sequence	TCCBUS3UF1_670 - hypothetical protein (Protein is coded in complementary strand; from 80309 to 76311)