Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 677444
End position: 677467
Length: 24

DNA sequence
>NC_017278, from 677444 to 677467 (24 bp); Thermus sp. CCB_US3_UF1 GGGCCAGGGCTAGGCCCAGGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 676516-677499	Sequence	TCCBUS3UF1_6870 - hypothetical protein (Protein is coded in complementary strand; from 677499 to 676516)