Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 42815
End position: 42838
Length: 24

DNA sequence
>NC_017278, from 42815 to 42838 (24 bp); Thermus sp. CCB_US3_UF1 CTGCCCCTTCCCCTGCCCCTCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 42745-44073	Sequence	TCCBUS3UF1_470 - hypothetical protein (Protein is coded in complementary strand; from 44073 to 42745)