Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 285222
End position: 285245
Length: 24

DNA sequence
>NC_017278, from 285222 to 285245 (24 bp); Thermus sp. CCB_US3_UF1 CAGGGCCAGGCCCAGGGCCAAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 284974-286146	Sequence	TCCBUS3UF1_2560 - Major facilitator superfamily MFS_1 (Protein is coded in complementary strand; from 286146 to 284974)