Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 2233288
End position: 2233311
Length: 24

DNA sequence
>NC_017278, from 2233288 to 2233311 (24 bp); Thermus sp. CCB_US3_UF1 CTCCACCTCCCCCTCCACCTCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2233205-2234173	Sequence	TCCBUS3UF1_22500 - hypothetical protein (Protein is coded in complementary strand; from 2234173 to 2233205)