Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 2227422
End position: 2227445
Length: 24

DNA sequence
>NC_017278, from 2227422 to 2227445 (24 bp); Thermus sp. CCB_US3_UF1 CCCCCACCACCACCCCCACCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2225450-2227567	Sequence	TCCBUS3UF1_22440 - Primosomal protein N' (Protein is coded in complementary strand; from 2227567 to 2225450)