Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 2152255
End position: 2152278
Length: 24

DNA sequence
>NC_017278, from 2152255 to 2152278 (24 bp); Thermus sp. CCB_US3_UF1 AGCCCTTCAGCCCTTAAGCCCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2152262-2153047	Sequence	TCCBUS3UF1_21700 - ABC transporter permease (Protein is coded in complementary strand; from 2153047 to 2152262)