Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 2149706
End position: 2149729
Length: 24

DNA sequence
>NC_017278, from 2149706 to 2149729 (24 bp); Thermus sp. CCB_US3_UF1 CAGGCCCAGGCCCAGGACCAGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2149224-2149907	Sequence	TCCBUS3UF1_21660 - hypothetical protein (Protein is coded in complementary strand; from 2149907 to 2149224)