Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 2082222
End position: 2082245
Length: 24

DNA sequence
>NC_017278, from 2082222 to 2082245 (24 bp); Thermus sp. CCB_US3_UF1 CCCCGCCACCGCCCCCGTCCCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2080978-2082801	Sequence	TCCBUS3UF1_20860 - Aldehyde ferredoxin oxidoreductase (Protein is coded in complementary strand; from 2082801 to 2080978)