Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 2002779
End position: 2002802
Length: 24

DNA sequence
>NC_017278, from 2002779 to 2002802 (24 bp); Thermus sp. CCB_US3_UF1 CCCGGTCCCGCTCCAGGTCCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2002172-2003002	Sequence	TCCBUS3UF1_20020 - pantothenate synthetase (Protein is coded in complementary strand; from 2003002 to 2002172)