Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1980670
End position: 1980693
Length: 24

DNA sequence
>NC_017278, from 1980670 to 1980693 (24 bp); Thermus sp. CCB_US3_UF1 CCAGGGCCCGGGCCAGGTCCAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1978821-1981475	Sequence	TCCBUS3UF1_19730 - hypothetical protein (Protein is coded in complementary strand; from 1981475 to 1978821)