Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1806849
End position: 1806872
Length: 24

DNA sequence
>NC_017278, from 1806849 to 1806872 (24 bp); Thermus sp. CCB_US3_UF1 AGGCCAAGGGCAAGGCGAAGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1805885-1807000	Sequence	TCCBUS3UF1_17990 - Permease (Protein is coded in complementary strand; from 1807000 to 1805885)