Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1790060
End position: 1790083
Length: 24

DNA sequence
>NC_017278, from 1790060 to 1790083 (24 bp); Thermus sp. CCB_US3_UF1 CGGGGCAGCGGGGCCGCGGGGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1789745-1790239	Sequence	TCCBUS3UF1_17850 - hypothetical protein (Protein is coded in complementary strand; from 1790239 to 1789745)