Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 164922
End position: 164945
Length: 24

DNA sequence
>NC_017278, from 164922 to 164945 (24 bp); Thermus sp. CCB_US3_UF1 GGGAGGGGGTGGGGGTGGGGGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 164618-165136	Sequence	TCCBUS3UF1_1500 - alpha-ribazole-5'-phosphate phosphatase (Protein is coded in complementary strand; from 165136 to 164618)