Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 163855
End position: 163878
Length: 24

DNA sequence
>NC_017278, from 163855 to 163878 (24 bp); Thermus sp. CCB_US3_UF1 GGGCGGGGGTGGGGGAGGGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 163770-164621	Sequence	TCCBUS3UF1_1490 - Cobalamin biosynthesis protein CobD (Protein is coded in complementary strand; from 164621 to 163770)