Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1610871
End position: 1610894
Length: 24

DNA sequence
>NC_017278, from 1610871 to 1610894 (24 bp); Thermus sp. CCB_US3_UF1 TGGGGCGGTGGGGTGGTGGGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1610805-1613801	Sequence	TCCBUS3UF1_16120 - protein translocase subunit secA (Protein is coded in complementary strand; from 1613801 to 1610805)