Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1481025
End position: 1481048
Length: 24

DNA sequence
>NC_017278, from 1481025 to 1481048 (24 bp); Thermus sp. CCB_US3_UF1 GGGCCTCGGCCTTGGCCTTGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1480547-1481113	Sequence	TCCBUS3UF1_14870 - hypothetical protein (Protein is coded in complementary strand; from 1481113 to 1480547)