Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 14745
End position: 14780
Length: 36

DNA sequence
>NC_017278, from 14745 to 14780 (36 bp); Thermus sp. CCB_US3_UF1 GGGCCAGGAGGAGGGCGAGGAGGTAGGCAAGGAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 14135-15061	Sequence	TCCBUS3UF1_150 - hypothetical protein (Protein is coded in complementary strand; from 15061 to 14135)