Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1382660
End position: 1382683
Length: 24

DNA sequence
>NC_017278, from 1382660 to 1382683 (24 bp); Thermus sp. CCB_US3_UF1 CGGCCTCGGCCAGGGCCTCGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1382167-1383069	Sequence	TCCBUS3UF1_13920 - hypothetical protein (Protein is coded in complementary strand; from 1383069 to 1382167)