Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1248655
End position: 1248678
Length: 24

DNA sequence
>NC_017278, from 1248655 to 1248678 (24 bp); Thermus sp. CCB_US3_UF1 AGGCCCAGGACCAGGCCCAGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1248415-1249584	Sequence	TCCBUS3UF1_12530 - hypothetical protein (Protein is coded in complementary strand; from 1249584 to 1248415)