Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1234693
End position: 1234720
Length: 28

DNA sequence
>NC_017278, from 1234693 to 1234720 (28 bp); Thermus sp. CCB_US3_UF1 AAGGGGAAGGGGGAAAGGAGAAAGGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1232998-1234752	Sequence	TCCBUS3UF1_12380 - Branched-chain amino acid transport system permease protein livM/branched-chain amino acid transport ATP-binding protein livG (Protein is coded in complementary strand; from 1234752 to 1232998)