Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1232197
End position: 1232223
Length: 27

DNA sequence
>NC_017278, from 1232197 to 1232223 (27 bp); Thermus sp. CCB_US3_UF1 CCACCCCCGCCACCACCGCCTCCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1231878-1232261	Sequence	TCCBUS3UF1_12360 - Phenylacetic acid degradation protein PaaI (Protein is coded in complementary strand; from 1232261 to 1231878)