Sequence retrieval

Genome: Thermus sp. CCB_US3_UF1
Start position: 1082382
End position: 1082408
Length: 27

DNA sequence
>NC_017278, from 1082382 to 1082408 (27 bp); Thermus sp. CCB_US3_UF1 GCCCAGGCGGCGCAGGCGGGCCAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1081975-1083984	Sequence	TCCBUS3UF1_11080 - Chromosome segregation SMC protein (Protein is coded in complementary strand; from 1083984 to 1081975)