Sequence retrieval

Genome: Sulfolobus islandicus HVE10/4
Start position: 1653170
End position: 1653205
Length: 36

DNA sequence
>NC_017275, from 1653170 to 1653205 (36 bp); Sulfolobus islandicus HVE10/4 GTCGTTGTAGAAGTTGTTGTAGTAGTTGTTGTAGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1652921-1654444	Sequence	SiH_1701 - hypothetical protein (Protein is coded in complementary strand; from 1654444 to 1652921)