Sequence retrieval

Genome: Sulfolobus islandicus HVE10/4
Start position: 729089
End position: 729118
Length: 30

DNA sequence
>NC_017275, from 729089 to 729118 (30 bp); Sulfolobus islandicus HVE10/4 AAAAGTAATAAGAAGAAATAAGAAATAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 728635-729150	Sequence	SiH_0746 - hypothetical protein (Protein is coded in complementary strand; from 729150 to 728635)