Sequence retrieval

Genome: Sulfolobus islandicus HVE10/4
Start position: 1889101
End position: 1889130
Length: 30

DNA sequence
>NC_017275, from 1889101 to 1889130 (30 bp); Sulfolobus islandicus HVE10/4 AAAGAAATTAAACGGAATTATAAGAAATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1888347-1889138	Sequence	SiH_1967 - molybdopterin binding domain-containing protein
ORF... 1889119-1889889	Sequence	SiH_1968 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 1889889 to 1889119)