Sequence retrieval

Genome: Sulfolobus islandicus HVE10/4
Start position: 1855068
End position: 1855097
Length: 30

DNA sequence
>NC_017275, from 1855068 to 1855097 (30 bp); Sulfolobus islandicus HVE10/4 CTTAAATCTTCTTCAGTCTTCTTTAACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1855041-1855670	Sequence	SiH_1931 - 6-phospho 3-hexuloisomerase (Protein is coded in complementary strand; from 1855670 to 1855041)