Sequence retrieval

Genome: Sulfolobus islandicus HVE10/4
Start position: 2363728
End position: 2363752
Length: 25

DNA sequence
>NC_017275, from 2363728 to 2363752 (25 bp); Sulfolobus islandicus HVE10/4 TTTCTCTTCTTATCTTATCTTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2362950-2363777	Sequence	SiH_2451 - hypothetical protein (Protein is coded in complementary strand; from 2363777 to 2362950)