Sequence retrieval

Genome: Sulfolobus islandicus HVE10/4
Start position: 874690
End position: 874713
Length: 24

DNA sequence
>NC_017275, from 874690 to 874713 (24 bp); Sulfolobus islandicus HVE10/4 TTCTTCTTCATCCTCTTCTTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 874475-874999	Sequence	SiH_0866 - hypothetical protein (Protein is coded in complementary strand; from 874999 to 874475)