Sequence retrieval

Genome: Sulfolobus islandicus HVE10/4
Start position: 640601
End position: 640624
Length: 24

DNA sequence
>NC_017275, from 640601 to 640624 (24 bp); Sulfolobus islandicus HVE10/4 CCTAGCCCTATCCCTAGTCCTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 640278-641360	Sequence	SiH_0651 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 641360 to 640278)