Sequence retrieval

Genome: Sulfolobus islandicus HVE10/4
Start position: 102827
End position: 102850
Length: 24

DNA sequence
>NC_017275, from 102827 to 102850 (24 bp); Sulfolobus islandicus HVE10/4 TTTTACCATTTTTCCATTTGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 102756-103790	Sequence	SiH_0120 - radical SAM protein (Protein is coded in complementary strand; from 103790 to 102756)