Sequence retrieval

Genome: Brucella suis 1330
Start position: 87038
End position: 87061
Length: 24

DNA sequence
>NC_017251, from 87038 to 87061 (24 bp); Brucella suis 1330 CACTGCCCTACTGCCCTACTGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 87054-87437	Sequence	BS1330_I0081 - hypothetical protein (Protein is coded in complementary strand; from 87437 to 87054)