Sequence retrieval

Genome: Brucella suis 1330
Start position: 736376
End position: 736399
Length: 24

DNA sequence
>NC_017251, from 736376 to 736399 (24 bp); Brucella suis 1330 TCCCTTACTCCCTTACTCCCTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 736397-737554	Sequence	BS1330_I0746 rnd ribonuclease D (Protein is coded in complementary strand; from 737554 to 736397)