Sequence retrieval

Genome: Brucella suis 1330
Start position: 37538
End position: 37573
Length: 36

DNA sequence
>NC_017251, from 37538 to 37573 (36 bp); Brucella suis 1330 AATGGCGGGAGAAAGGGCGGGAGAAATGGCCAGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 36357-37640	Sequence	BS1330_I0031 - transglycosylase (Protein is coded in complementary strand; from 37640 to 36357)