Sequence retrieval

Genome: Brucella suis 1330
Start position: 28827
End position: 28850
Length: 24

DNA sequence
>NC_017251, from 28827 to 28850 (24 bp); Brucella suis 1330 TCTTCCTCTTCGGCTTCCTCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 28617-29000	Sequence	BS1330_I0024 - hypothetical protein (Protein is coded in complementary strand; from 29000 to 28617)