Sequence retrieval

Genome: Brucella suis 1330
Start position: 1959981
End position: 1960016
Length: 36

DNA sequence
>NC_017251, from 1959981 to 1960016 (36 bp); Brucella suis 1330 TGATCGTTATGATGATCGTGATGGTGATCGTGGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1959576-1960748	Sequence	BS1330_I2029 - cobalamin synthesis protein/P47K family protein (Protein is coded in complementary strand; from 1960748 to 1959576)