Sequence retrieval

Genome: Brucella suis 1330
Start position: 1902989
End position: 1903024
Length: 36

DNA sequence
>NC_017251, from 1902989 to 1903024 (36 bp); Brucella suis 1330 ATGAAACCCGCAATGAAACCTGTAATGAAACCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1902625-1902990	Sequence	BS1330_I1967 - 6-pyruvoyl tetrahydrobiopterin synthase
ORF... 1902990-1903745	Sequence	BS1330_I1968 - radical activating enzyme