Sequence retrieval

Genome: Brucella suis 1330
Start position: 1483842
End position: 1483865
Length: 24

DNA sequence
>NC_017251, from 1483842 to 1483865 (24 bp); Brucella suis 1330 CCGGCTCCGCCTCCGGCTTCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1483286-1484827	Sequence	BS1330_I1528 - hypothetical protein (Protein is coded in complementary strand; from 1484827 to 1483286)